Questão discursiva sobre código genético.

(UFLA) Considerando que a replicação da molécula de DNA é semiconservativa, responda às questões abaixo.
a) Dada a seguinte fita de DNA: AACTATATTTCGAAACTGTAT, qual a sequência da fita complementar?

b) Supondo uma fita-molde com a sequência ATGTGTGGATCTACACCTAGA, qual a sequência de bases do mRNA (RNA mensageiro)?

c) Utilizando a tabela de códons abaixo, dê a sequência de aminoácidos sintetizados baseando-se na tradução do seguinte mRNA: AUGACUGACUUACCCAAUUAC.

Resolução:
A) TTG ATA TAA AGC TTT GAC ATA

B) UAC ACA CCU AGA UGU GGA UCU

C) Metionina – Treonina – Ácido aspártico – Leucina – Prolina – Asparagina – Tirosina.

Veja também:
Simulado sobre ácidos nucleicos.
 Questões comentadas sobre membrana plasmática.

0 comments… add one

Leave a Comment

Esse site utiliza o Akismet para reduzir spam. Aprenda como seus dados de comentários são processados.