Questão comentada sobre código genético, da UFRGS

(UFRGS/2012) O quadro abaixo representa o código genético universal.

A molécula de RNA mensageiro com a sequência CGAAUGACAAAAGGAUAACGU produz o segmento de proteína
A) Met – Tre – Lis – Gli – Arg.
B) Tre – Arg – Met.
C) Arg – Met – Tre – Lis – Gli.
D) Met – Tre – Lis – Gli.
E) Leu – Arg – Met – Tre – Lis – Gli.

RESOLUÇÃO:
É importante lembrar que o gene inicia-se com a sequência AUG, que codifica o aminoácido metionina.
Então, o RNA mensageiro acima, apresenta a seguinte sequência de códons (em negrito).

CGA AUG ACA AAA GGA UAA CGU

Em vermelho, tem-se um códon de parada (trinca stop).

Então, analisando a tabela fornecida, tem-se que a sequência de aminoácidos codificada pelo segmento (somente trincas em negrito)  fornecido é:
Met – Tre – Lis – Gli

RESP.: D

VEJA TAMBÉM:
Questão discursiva sobre código genético, da UFLA
Questão comentada sobre códons, da Souza Marques 2013

0 comments… add one

Leave a Comment

Esse site utiliza o Akismet para reduzir spam. Aprenda como seus dados de comentários são processados.